Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 5 de 5
Filtrar
Mais filtros








Base de dados
Intervalo de ano de publicação
1.
Zootaxa ; 5406(3): 461-473, 2024 Feb 07.
Artigo em Inglês | MEDLINE | ID: mdl-38480139

RESUMO

A survey of planthoppers associated with palms in Madagascar was initiated to assess putative vectors of a phytoplasma causing palm decline. Here a derbid collected from a Chinese fan palm (Livistona chinensis) is described as Paraphenice fluctus sp. n., with supplemental molecular data for the cytochrome c oxidase subunit I (COI) gene, 18S rRNA gene, and D9D10 expansion region of the 28S rRNA gene.


Assuntos
Arecaceae , Hemípteros , Animais , Hemípteros/genética , Madagáscar , Arecaceae/genética , Inquéritos e Questionários
2.
Plant Dis ; 2022 Oct 20.
Artigo em Inglês | MEDLINE | ID: mdl-36265144

RESUMO

Lethal Yellowing (LY) disease causes major damage to palms in Central America and the Caribbean. It has been reported as far south as Antigua (Myrie et al., 2014). LY affects over forty palm species, seriously impacts the coconut industry and alters the landscapes on islands with a tourist-based economy. In March 2021, the presence of LY disease was regularly monitored in Guadeloupe. Two palm species (Cocos nucifera and Pritchardia sp.) died on a private property in Saint-Anne, Grande Terre. Yellowing of lower fronds and necrosis of inflorescences were reported on some neighboring palms. One symptomatic Cocos nucifera (GP21-007) and four symptomatic Pritchardia sp. (GP21-005, GP21-006, GP21-008 and GP21-009) were sampled by stem drilling. Samples from four asymptomatic coconut trees (GP21-001 to GP21-004) were collected in the locality of Deshaies. DNA was extracted from the nine sawdust samples following a cetyltrimethylammonium bromide (CTAB) modified protocol (Doyle and Doyle, 1990). A quantitative polymerase chain reaction (PCR), following the protocol described by Christensen et al. (2004), was performed on DNA to diagnose the presence of phytoplasmas. An exponential amplification was observed for all DNA extracts from symptomatic palm samples (threshold number of PCR cycles (Ct) ranged from 18.50 to 23.58). DNA from asymptomatic samples yielded negative results (undetermined Ct). To identify the phytoplasma associated with LY, DNA samples were subjected to PCR, based on the 16SrRNA gene, plus internal transcribed spacers (ITS) using P1-1T (Pilet et al., 2021)/P7 (Schneider et al., 1995) primers, and secA gene using the primer pair secAFor1/secARev1 (Hodgetts et al. 2008). Amplicons of 1.8 kb covering the 16S ribosomal operon and 830 bp for the secA gene were produced using DNA from symptomatic trees. All amplicons were double strand sequenced (Genewiz, UK). The corresponding sequences were deposited in GenBank and subjected to BLASTn on NCBI. Sequences of the ribosomal operon gene (accession no. ON521114 to ON521118) were identical for the five positive samples. Sequencing revealed two distinct ribosomal operons with heterozygous peaks on the DNA chromatogram. The first aMino ambiguity (M = Adenine or Cytosine) was observed in the 16Sr RNA gene. The second was observed in the first intergenic transcript spacer. The 16S rDNA sequence (M = Cytosine) presented 100% identity with accession no. HQ613874 and 99.93% with accession no. U18747, the reference sequence for 'Candidatus Phytoplasma palmae'. The virtual RFLP pattern derived from the 16S rDNA F2nR2 fragment and identified using iPhyclassifier (Zhao et al. 2009) was identical to the reference pattern for the 16SrIV-A subgroup. A unique sequence was obtained for the partial secA gene (OP136139 to OP136143), sharing 100% identity with EU267187 for the palm LY phytoplasma preprotein translocase subunit (secA) gene. This is the first report of 'Ca. Phytoplasma palmae' (subgroup 16SrIV-A) associated with palm LY disease on Cocos nucifera and Pritchardia sp. in Guadeloupe. Measures to eradicate LY were implemented as soon as its presence was confirmed in Guadeloupe. LY phytoplasmas continue to spread in the Caribbean and are approaching South America, where the known vector, Haplaxius crudus, has already been reported (Silva et al., 2019). This poses a major threat to the coconut economy and the diversity of palm trees.

3.
Plant Dis ; 2021 Jun 09.
Artigo em Inglês | MEDLINE | ID: mdl-34105376

RESUMO

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

4.
Appl Environ Microbiol ; 85(8)2019 04 15.
Artigo em Inglês | MEDLINE | ID: mdl-30770404

RESUMO

To sustain epidemiological studies on coconut lethal yellowing disease (CLYD), a devastating disease in Africa caused by a phytoplasma, we developed a multilocus sequence typing (MLST) scheme for "Candidatus Phytoplasma palmicola" based on eight housekeeping genes. At the continental level, eight different sequence types were identified among 132 "Candidatus Phytoplasma palmicola"-infected coconuts collected in Ghana, Nigeria, and Mozambique, where CLYD epidemics are still very active. "Candidatus Phytoplasma palmicola" appeared to be a bacterium that is subject to strong bottlenecks, reducing the fixation of positively selected beneficial mutations into the bacterial population. This phenomenon, as well as a limited plant host range, might explain the observed country-specific distribution of the eight haplotypes. As an alternative means to increase fitness, bacteria can also undergo genetic exchange; however, no evidence for such recombination events was found for "Candidatus Phytoplasma palmicola." The implications for CLYD epidemiology and prophylactic control are discussed. The usefulness of seven housekeeping genes to investigate the genetic diversity in the genus "Candidatus Phytoplasma" is underlined.IMPORTANCE Coconut is an important crop for both industry and small stakeholders in many intertropical countries. Phytoplasma-associated lethal yellowing-like diseases have become one of the major pests that limit coconut cultivation as they have emerged in different parts of the world. We developed a multilocus sequence typing scheme (MLST) for tracking epidemics of "Ca Phytoplasma palmicola," which is responsible for coconut lethal yellowing disease (CLYD) on the African continent. MLST analysis applied to diseased coconut samples collected in western and eastern African countries also showed the existence of three distinct populations of "Ca Phytoplasma palmicola" with low intrapopulation diversity. The reasons for the observed strong geographic patterns remain to be established but could result from the lethality of CLYD and the dominance of short-distance insect-mediated transmission.


Assuntos
Tipagem de Sequências Multilocus/métodos , Phytoplasma/classificação , Phytoplasma/genética , África , Animais , Técnicas de Tipagem Bacteriana , DNA Bacteriano/genética , Genes Essenciais , Variação Genética , Especificidade de Hospedeiro , Insetos/microbiologia , Filogenia , Phytoplasma/isolamento & purificação , Doenças das Plantas/microbiologia , RNA Ribossômico 16S/genética
5.
Phytopathology ; 97(3): 338-43, 2007 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-18943654

RESUMO

ABSTRACT The use of partially resistant cultivars should become an essential component of a sustainable management strategy of potato late blight, caused by Phytophthora infestans. It is therefore important to determine to what extent P. infestans populations can be selected for increased aggressiveness by potato cultivars with different levels of partial resistance. To this end, we sampled P. infestans populations from France and Morocco, chosen as locations where late blight occurs regularly but which differ in the distribution of potato cultivars. Cross-inoculation experiments were used to determine the aggressiveness of all populations to potato cvs. Bintje (prevalent in France but not grown in Morocco) and Désirée (popular in Morocco but cultivated to a very small extent in France). French populations were more aggressive on cv. Bintje than on cv. Désirée, irrespective of the site they were sampled from. Their aggressiveness increased between early and late samplings, suggesting that both cultivars selected for increased aggressiveness during epidemics. By contrast, Moroccan populations were more aggressive on Désirée, regarded as partially resistant in Europe, than on Bintje, highly susceptible under European conditions. These data indicate that P. infestans populations adapt to locally dominant cultivars, irrespective of their resistance levels, and can therefore overcome polygenic, partial resistance. This adaptive pattern may render partial resistance nondurable if not properly managed.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA